import.tRNAdb {tRNAdbImport} | R Documentation |
title
TRNA_DB_URL TRNA_DB_URL_MT import.tRNAdb.id( tdbID, database = c("DNA", "RNA"), origin = c("allothers", "plastid", "mitochondrial"), dbURL = TRNA_DB_URL, verbose = FALSE ) import.mttRNAdb.id(mtdbID, dbURL = TRNA_DB_URL_MT, verbose = FALSE) import.tRNAdb.blast( blastSeq, database = c("DNA", "RNA"), origin = c("allothers", "plastid", "mitochondrial"), dbURL = TRNA_DB_URL, verbose = FALSE ) import.tRNAdb( organism = "", strain = "", taxonomyID = "", aminoacids = "", anticodons = "", sequences = list(), structures = list(), reference = "", comment = "", pubmed = "", genes = "", database = c("DNA", "RNA"), origin = c("allothers", "plastid", "mitochondrial"), dbURL = TRNA_DB_URL, verbose = FALSE ) import.mttRNAdb( organism = "", strain = "", taxonomyID = "", aminoacids = "", anticodons = "", sequences = list(), structures = list(), reference = "", comment = "", pubmed = "", genes = "", dbURL = TRNA_DB_URL_MT, verbose = FALSE ) tRNAdb2GFF(input)
tdbID |
a tRNAdb ID |
database |
"RNA" or "DNA" |
origin |
one ore more of "plastid", "mitochondrial" or "allothers" |
dbURL |
the URL of the tRNA db |
verbose |
whether to report verbose information from the httr calls |
mtdbID |
a mtRNAdb ID |
blastSeq |
a sequence to use for a blast search |
organism |
a organism name as a character string |
strain |
a strain information as a character string |
taxonomyID |
organism and strain information as a taxonom ID |
aminoacids |
a character vector of amino acids as a three letter code |
anticodons |
a character vector of anticodon sequences |
sequences |
a named (1-15) list of sequences, which are used for the search |
structures |
a named (1-15) list of structures, which are used for the
search. Please use the |
reference |
a reference as a character string |
comment |
a comment as a character string |
pubmed |
a pubmed ID |
genes |
a gene name as a character string |
input |
a GRanges object which passes the |
An object of class character
of length 1.
An object of class character
of length 1.
a GRanges object containing the information from the tRNA db
import.tRNAdb(organism = "Saccharomyces cerevisiae", aminoacids = c("Phe","Ala")) import.tRNAdb.id(tdbID = "tdbD00000785") import.tRNAdb.blast(blastSeq = "GCGGATTTAGCTCAGTTGGGAGAGCGCCAGACTGAAGATCTGGAGGTCCTGTGTTCGATCCACAGAATTCGCA") import.mttRNAdb(organism = "Bos taurus", aminoacids = c("Phe","Ala")) import.mttRNAdb.id(mtdbID = "mtdbD00000900")