Using Bioconductor for Annotation

Bioconductor has extensive facilities for mapping between microarray probe, gene, pathway, gene ontology, homology and other annotations.

Bioconductor has built-in representations of GO, KEGG, vendor, and other annotations, and can easily access NCBI, Biomart, UCSC, and other sources.

Package Types

Bioconductor contains many different types of annotation packages. You can browse the currently available types here [here](http://www.bioconductor.org/packages/release/BiocViews.html#___PackageType) by simply using the bioconductor web site. On the web site you will see many different kinds of packages. One of the largest categories are the many platform specific packages that contain annotation data about a particular microarray platform (ChipDb objects). But there are also many org packages that contain gene centered data about an organism (OrgDb objects). And there are even packages that contain genome centered data about an organisms transcriptome (TxDb objects) or genome (BSgenome objects). This document will demonstrate some of the more typical use cases for most of the more popular kinds of annotation packages (and their associated objects). The above diagram shows some of the major classes of object types that are supported in this project and diagrams how they are typically related to each other. Later we will also cover a class of meta annotation object that can wrap access to several different kinds of related annotation objects into a single container (OrganismDb objects).

Sample OrgDb Workflow

The organism wide gene centered packages (OrgDb packages) each contain gene centered data for an organism. These packages are the primary place for storing data that can be directly associated with genes. Lets take a closer look at the organism package for human:

library(org.Hs.eg.db)

Once loaded, each OrgDb object can be accessed using the following four methods:

To list the kinds of things that can be retrieved, use the columns method.

columns(org.Hs.eg.db)
##  [1] "ENTREZID"     "PFAM"         "IPI"          "PROSITE"     
##  [5] "ACCNUM"       "ALIAS"        "CHR"          "CHRLOC"      
##  [9] "CHRLOCEND"    "ENZYME"       "MAP"          "PATH"        
## [13] "PMID"         "REFSEQ"       "SYMBOL"       "UNIGENE"     
## [17] "ENSEMBL"      "ENSEMBLPROT"  "ENSEMBLTRANS" "GENENAME"    
## [21] "UNIPROT"      "GO"           "EVIDENCE"     "ONTOLOGY"    
## [25] "GOALL"        "EVIDENCEALL"  "ONTOLOGYALL"  "OMIM"        
## [29] "UCSCKG"

To list the kinds of things that can be used as keys we can use the keytypes method

keytypes(org.Hs.eg.db)
##  [1] "ENTREZID"     "PFAM"         "IPI"          "PROSITE"     
##  [5] "ACCNUM"       "ALIAS"        "CHR"          "CHRLOC"      
##  [9] "CHRLOCEND"    "ENZYME"       "MAP"          "PATH"        
## [13] "PMID"         "REFSEQ"       "SYMBOL"       "UNIGENE"     
## [17] "ENSEMBL"      "ENSEMBLPROT"  "ENSEMBLTRANS" "GENENAME"    
## [21] "UNIPROT"      "GO"           "EVIDENCE"     "ONTOLOGY"    
## [25] "GOALL"        "EVIDENCEALL"  "ONTOLOGYALL"  "OMIM"        
## [29] "UCSCKG"

And to extract viable keys of a particular kind (keytype), we can use the keys method.

head(keys(org.Hs.eg.db, keytype="ENTREZID"))
## [1] "1"         "10"        "100"       "1000"      "10000"     "100008586"

Since the keys method can tell us specific things that can be used as keys, here we will use it to extract a few ids to use for demonstrating the fourth method type.

ids = head(keys(org.Hs.eg.db, keytype="ENTREZID"))

Once you have some ids that you want to look up data for, the select method allows you to map these ids as long as you use the columns argument to indicate what you need to know and the keytype argument to specify what kind of keys they are.

select(org.Hs.eg.db, keys=ids, columns="SYMBOL", keytype="ENTREZID")
##    ENTREZID  SYMBOL
## 1         1    A1BG
## 2        10    NAT2
## 3       100     ADA
## 4      1000    CDH2
## 5     10000    AKT3
## 6 100008586 GAGE12F

And since the columns argument can take a vector of valid columns, you can look up multiple things at once.

select(org.Hs.eg.db, keys=ids, columns=c("GENENAME", "SYMBOL"), keytype="ENTREZID")
##    ENTREZID                                              GENENAME  SYMBOL
## 1         1                                alpha-1-B glycoprotein    A1BG
## 2        10 N-acetyltransferase 2 (arylamine N-acetyltransferase)    NAT2
## 3       100                                   adenosine deaminase     ADA
## 4      1000             cadherin 2, type 1, N-cadherin (neuronal)    CDH2
## 5     10000         v-akt murine thymoma viral oncogene homolog 3    AKT3
## 6 100008586                                         G antigen 12F GAGE12F

But where would we normally get the “ids” that we would pass in to the keys argument? Usually these kinds of ids come from the result of a data analysis. Here I will load an experiment data package to provide us with an example data set to look at:

library("parathyroidSE")
## Warning: package 'parathyroidSE' was built under R version 3.1.1
data(exonicParts)
exonicParts[1:3]
## GRanges object with 3 ranges and 3 metadata columns:
##       seqnames               ranges strand |         gene_id
##          <Rle>            <IRanges>  <Rle> | <CharacterList>
##   [1]        X [99883667, 99884983]      - | ENSG00000000003
##   [2]        X [99885756, 99885863]      - | ENSG00000000003
##   [3]        X [99887482, 99887537]      - | ENSG00000000003
##               tx_name exonic_part
##       <CharacterList>   <integer>
##   [1] ENST00000373020           1
##   [2] ENST00000373020           2
##   [3] ENST00000373020           3
##   -------
##   seqinfo: 580 sequences (1 circular) from an unspecified genome

Now having just loaded this data set, I can extract the ensembl gene IDs contained in this object like this:

ids = unlist(mcols(exonicParts)$gene_id)
head(ids)
## [1] "ENSG00000000003" "ENSG00000000003" "ENSG00000000003" "ENSG00000000003"
## [5] "ENSG00000000003" "ENSG00000000003"

From here I can look up gene symbols for these ids by using the select method like this. Notice how I have to specify the correct (and different from before) keytype in order to extract these:

res <- select(org.Hs.eg.db, keys=ids, columns="SYMBOL", keytype="ENSEMBL")
head(res)
##           ENSEMBL SYMBOL
## 1 ENSG00000000003 TSPAN6
## 2 ENSG00000000003 TSPAN6
## 3 ENSG00000000003 TSPAN6
## 4 ENSG00000000003 TSPAN6
## 5 ENSG00000000003 TSPAN6
## 6 ENSG00000000003 TSPAN6

And if I am careful to make sure that there were not any many to one relationships changing the size of the result data.frame, then I can even put these gene symbols back into the initial object:

dim(res)[1] == length(exonicParts)
## [1] TRUE
newMcols <- cbind(mcols(exonicParts), res[,2,drop=FALSE])
mcols(exonicParts) <- newMcols
exonicParts[1:3]
## GRanges object with 3 ranges and 4 metadata columns:
##       seqnames                 ranges  strand   |           gene_id
##        "<Rle>"            "<IRanges>" "<Rle>" "|"          "<list>"
##   [1]      "X" "[99883667, 99884983]"     "-" "|" "ENSG00000000003"
##   [2]      "X" "[99885756, 99885863]"     "-" "|" "ENSG00000000003"
##   [3]      "X" "[99887482, 99887537]"     "-" "|" "ENSG00000000003"
##                 tx_name exonic_part        SYMBOL
##                "<list>" "<integer>" "<character>"
##   [1] "ENST00000373020"           1      "TSPAN6"
##   [2] "ENST00000373020"           2      "TSPAN6"
##   [3] "ENST00000373020"           3      "TSPAN6"
##   -------
##   seqinfo: 580 sequences (1 circular) from an unspecified genome

Of course we can look up many things other than just gene names and symbols. For example, we could also extract the GO ids associated with the first id like this:

id = ids[1]
res <- select(org.Hs.eg.db, keys=id, columns="GO", keytype="ENSEMBL")
## Warning in .generateExtraRows(tab, keys, jointype): 'select' resulted in
## 1:many mapping between keys and return rows
head(res)
##           ENSEMBL         GO EVIDENCE ONTOLOGY
## 1 ENSG00000000003 GO:0004871      IMP       MF
## 2 ENSG00000000003 GO:0005515      IPI       MF
## 3 ENSG00000000003 GO:0007165      IMP       BP
## 4 ENSG00000000003 GO:0016021      IEA       CC
## 5 ENSG00000000003 GO:0039532      IMP       BP
## 6 ENSG00000000003 GO:0043123      IMP       BP

You may have noticed that the above request results in many rows for just one input id (and that a warning was issued about this). Sometimes when you use select you may ask for columns that will result in select having to return multiple values for each key that you passed in. This is caused by the structure of the underlying data. This kind of data is sometimes said to have a many to one relationship because there are many things that can match to each key. When this happens select() will return multiple rows for each key that you used as input because the return value for select is a data.frame object. A warning is issued in this case because this behavior might not be what you were expecting. If you request multiple many to one relationships at once, it will result in a multiplication of the returned rows as each row will represent a unique combination of the data that you asked for. This is not recommended as you can very quickly generate a data.frame object that is both very large and simultaneously not very useful. For best results, use select carefully, and avoid requesting more than one many to one value at any given time.

When making use of GO ids, you can also use the GO.db package to find the Terms associated with those GO ids. The GO.db package will load a GOdb object that can be used in a manner similar to what we just saw with our OrgDb object for org.Hs.eg.db. And we can use the same four methods that we just learned about (columns, keytypes, keys and select), to extract whatever data we need.

library("GO.db")
## 
head(res$GO)  ## shows what we are using as keys
## [1] "GO:0004871" "GO:0005515" "GO:0007165" "GO:0016021" "GO:0039532"
## [6] "GO:0043123"
head(select(GO.db, keys=res$GO, columns="TERM", keytype="GOID"))
##         GOID
## 1 GO:0004871
## 2 GO:0005515
## 3 GO:0007165
## 4 GO:0016021
## 5 GO:0039532
## 6 GO:0043123
##                                                                                              TERM
## 1                                                                      signal transducer activity
## 2                                                                                 protein binding
## 3                                                                             signal transduction
## 4                                                                  integral component of membrane
## 5 negative regulation of viral-induced cytoplasmic pattern recognition receptor signaling pathway
## 6                                      positive regulation of I-kappaB kinase/NF-kappaB signaling

Exercises for OrgDb objects.

Exercise 1: Look at the help page for the different columns and keytypes values with: help(“SYMBOL”). Now use this information and what we just described to look up the entrez gene and chromosome for the gene symbol “MSX2”.

Exercise 2: In the previous exercise we had to use gene symbols as keys. But in the past this kind of behavior has sometimes been inadvisable because some gene symbols are used as the official symbol for more than one gene. To learn if this is still happening take advantage of the fact that entrez gene ids are uniquely assigned, and extract all of the gene symbols and their associated entrez gene ids from the org.Hs.eg.db package. Then check the symbols for redundancy.

[ Back to top ]

Sample ChipDb Workflow

The following illustrates a typical R / Bioconductor session for a ChipDb package. It continues the differential expression workflow, taking a 'top table' of differentially expressed probesets and discovering the genes probed, and the Gene Ontology pathways to which they belong.

First lets consider some typical probe Ids. If you have done a microarray analysis before you have probably already run into IDs like this. They are typically manufacturer assigned and normally only relevant to a small number of chips. Below I am just going to demonstrate on 6 probe Ids from the u133 2.0 affymetrix platform.

## Affymetrix U133 2.0 array IDs of interest; these might be
## obtained from
##
##   tbl <- topTable(efit, coef=2)
##   ids <- tbl[["ID"]]
##
## as part of a more extensive workflow.
ids <- c("39730_at", "1635_at", "1674_at", "40504_at", "40202_at")

Load libraries as sources of annotation

library("hgu95av2.db")

And from here you can use the new ChipDb object in the same way that you learned to use an OrgDb object before. The only real change is that the ChipDb object will also have data about how platform specific probes match to specific genes. So for example:

columns(hgu95av2.db)
##  [1] "PROBEID"      "ENTREZID"     "PFAM"         "IPI"         
##  [5] "PROSITE"      "ACCNUM"       "ALIAS"        "CHR"         
##  [9] "CHRLOC"       "CHRLOCEND"    "ENZYME"       "MAP"         
## [13] "PATH"         "PMID"         "REFSEQ"       "SYMBOL"      
## [17] "UNIGENE"      "ENSEMBL"      "ENSEMBLPROT"  "ENSEMBLTRANS"
## [21] "GENENAME"     "UNIPROT"      "GO"           "EVIDENCE"    
## [25] "ONTOLOGY"     "GOALL"        "EVIDENCEALL"  "ONTOLOGYALL" 
## [29] "OMIM"         "UCSCKG"
keytypes(hgu95av2.db)
##  [1] "ENTREZID"     "PFAM"         "IPI"          "PROSITE"     
##  [5] "ACCNUM"       "ALIAS"        "CHR"          "CHRLOC"      
##  [9] "CHRLOCEND"    "ENZYME"       "MAP"          "PATH"        
## [13] "PMID"         "REFSEQ"       "SYMBOL"       "UNIGENE"     
## [17] "ENSEMBL"      "ENSEMBLPROT"  "ENSEMBLTRANS" "GENENAME"    
## [21] "UNIPROT"      "GO"           "EVIDENCE"     "ONTOLOGY"    
## [25] "GOALL"        "EVIDENCEALL"  "ONTOLOGYALL"  "PROBEID"     
## [29] "OMIM"         "UCSCKG"
columns <- c("PFAM","SYMBOL")
select(hgu95av2.db, keys=ids, columns, keytype="PROBEID")
## Warning in .generateExtraRows(tab, keys, jointype): 'select' resulted in
## 1:many mapping between keys and return rows
##     PROBEID    PFAM SYMBOL
## 1  39730_at PF08919   ABL1
## 2  39730_at PF07714   ABL1
## 3  39730_at PF00018   ABL1
## 4  39730_at PF00017   ABL1
## 5   1635_at PF08919   ABL1
## 6   1635_at PF07714   ABL1
## 7   1635_at PF00018   ABL1
## 8   1635_at PF00017   ABL1
## 9   1674_at PF07714   YES1
## 10  1674_at PF00018   YES1
## 11  1674_at PF00017   YES1
## 12 40504_at PF01731   PON2
## 13 40202_at    <NA>   KLF9

Exercises for ChipDb objects.

Exercise 3: Examine the gene symbols for both the hgu95av2.db and the org.Hs.eg.db packages. Which one has more gene symbols? Which one has more gene symbols that can be mapped to an entrez gene ID? Which object seems to contain more information?

[ Back to top ]

Sample TxDb Workflow

The genome centered TxDb packages support the same interface as that ChipDb and the OrgDb packages.

library(TxDb.Hsapiens.UCSC.hg19.knownGene)
txdb <- TxDb.Hsapiens.UCSC.hg19.knownGene ## done for convenience
keys <- head(keys(txdb, keytype="GENEID"), n=2)
columns <- c("TXNAME", "TXSTART","TXSTRAND")
select(txdb, keys, columns, keytype="GENEID")
## Warning in .generateExtraRows(tab, keys, jointype): 'select' resulted in
## 1:many mapping between keys and return rows
##   GENEID     TXNAME TXSTRAND  TXSTART
## 1      1 uc002qsd.4        - 58858172
## 2      1 uc002qsf.2        - 58859832
## 3     10 uc003wyw.1        + 18248755

But in addition to supporting the standard set of methods (select, keytypes, keys and columns). The TxDb objects also support methods to retrieve the annotations as ranges. These accessors break down into two basic categories. The most basic will return annotations as GRanges objects. Some examples of these are: transcripts(), exons() and cds().

This for example will return all the transcripts as ranges:

transcripts(txdb)
## GRanges object with 82960 ranges and 2 metadata columns:
##           seqnames               ranges strand   |     tx_id     tx_name
##              <Rle>            <IRanges>  <Rle>   | <integer> <character>
##       [1]     chr1     [ 11874,  14409]      +   |         1  uc001aaa.3
##       [2]     chr1     [ 11874,  14409]      +   |         2  uc010nxq.1
##       [3]     chr1     [ 11874,  14409]      +   |         3  uc010nxr.1
##       [4]     chr1     [ 69091,  70008]      +   |         4  uc001aal.1
##       [5]     chr1     [321084, 321115]      +   |         5  uc001aaq.2
##       ...      ...                  ...    ... ...       ...         ...
##   [82956]     chrY [27605645, 27605678]      -   |     78803  uc004fwx.1
##   [82957]     chrY [27606394, 27606421]      -   |     78804  uc022cpc.1
##   [82958]     chrY [27607404, 27607432]      -   |     78805  uc004fwz.3
##   [82959]     chrY [27635919, 27635954]      -   |     78806  uc022cpd.1
##   [82960]     chrY [59358329, 59360854]      -   |     78807  uc011ncc.1
##   -------
##   seqinfo: 93 sequences (1 circular) from hg19 genome

And this will return all the exons as ranges:

exons(txdb)
## GRanges object with 289969 ranges and 1 metadata column:
##            seqnames               ranges strand   |   exon_id
##               <Rle>            <IRanges>  <Rle>   | <integer>
##        [1]     chr1       [11874, 12227]      +   |         1
##        [2]     chr1       [12595, 12721]      +   |         2
##        [3]     chr1       [12613, 12721]      +   |         3
##        [4]     chr1       [12646, 12697]      +   |         4
##        [5]     chr1       [13221, 14409]      +   |         5
##        ...      ...                  ...    ... ...       ...
##   [289965]     chrY [27607404, 27607432]      -   |    277746
##   [289966]     chrY [27635919, 27635954]      -   |    277747
##   [289967]     chrY [59358329, 59359508]      -   |    277748
##   [289968]     chrY [59360007, 59360115]      -   |    277749
##   [289969]     chrY [59360501, 59360854]      -   |    277750
##   -------
##   seqinfo: 93 sequences (1 circular) from hg19 genome

But these operations will also support the extraction of extra metadata. All extra data will be inserted into the metadata slot of the returned GRanges object. So for example you could spice up your call to transcripts by using the columns argument like this.

transcripts(txdb, columns = c("tx_id","tx_name","gene_id"))
## GRanges object with 82960 ranges and 3 metadata columns:
##           seqnames               ranges strand   |     tx_id     tx_name
##              <Rle>            <IRanges>  <Rle>   | <integer> <character>
##       [1]     chr1     [ 11874,  14409]      +   |         1  uc001aaa.3
##       [2]     chr1     [ 11874,  14409]      +   |         2  uc010nxq.1
##       [3]     chr1     [ 11874,  14409]      +   |         3  uc010nxr.1
##       [4]     chr1     [ 69091,  70008]      +   |         4  uc001aal.1
##       [5]     chr1     [321084, 321115]      +   |         5  uc001aaq.2
##       ...      ...                  ...    ... ...       ...         ...
##   [82956]     chrY [27605645, 27605678]      -   |     78803  uc004fwx.1
##   [82957]     chrY [27606394, 27606421]      -   |     78804  uc022cpc.1
##   [82958]     chrY [27607404, 27607432]      -   |     78805  uc004fwz.3
##   [82959]     chrY [27635919, 27635954]      -   |     78806  uc022cpd.1
##   [82960]     chrY [59358329, 59360854]      -   |     78807  uc011ncc.1
##                   gene_id
##           <CharacterList>
##       [1]       100287102
##       [2]       100287102
##       [3]       100287102
##       [4]           79501
##       [5]                
##       ...             ...
##   [82956]                
##   [82957]                
##   [82958]                
##   [82959]                
##   [82960]                
##   -------
##   seqinfo: 93 sequences (1 circular) from hg19 genome

The 2nd kind of range accessor supported by TxDb objects are the ones that return GRangesList objects. Some examples of these are: transcriptsBy(), exonsBy() or cdsBy(). These accessors just allow you to return a GRangesList object that contains the desired ranges by split up by some important feature type that is specified using the “by” argument. A typical case is to extract all the transcript ranges known for all the genes. You can do that like this:

transcriptsBy(txdb, by="gene")
## GRangesList object of length 23459:
## $1 
## GRanges object with 2 ranges and 2 metadata columns:
##       seqnames               ranges strand |     tx_id     tx_name
##          <Rle>            <IRanges>  <Rle> | <integer> <character>
##   [1]    chr19 [58858172, 58864865]      - |     70455  uc002qsd.4
##   [2]    chr19 [58859832, 58874214]      - |     70456  uc002qsf.2
## 
## $10 
## GRanges object with 1 range and 2 metadata columns:
##       seqnames               ranges strand | tx_id    tx_name
##   [1]     chr8 [18248755, 18258723]      + | 31944 uc003wyw.1
## 
## $100 
## GRanges object with 1 range and 2 metadata columns:
##       seqnames               ranges strand | tx_id    tx_name
##   [1]    chr20 [43248163, 43280376]      - | 72132 uc002xmj.3
## 
## ...
## <23456 more elements>
## -------
## seqinfo: 93 sequences (1 circular) from hg19 genome

[ Back to top ]

Exercises for TxDb objects.

Exercise 4: Use the accessors for the TxDb.Hsapiens.UCSC.hg19.knownGene package to retrieve the gene id, transcript name and transcript chromosome for all the transcripts. Do this using both the select() method and also using the transcripts() method. What is the difference in the output?

Exercise 5: Load the TxDb.Athaliana.BioMart.plantsmart22 package. This package is not from UCSC and it is based on plantsmart. Now use select or one of the range based accessors to look at the gene ids from this TxDb object. How tdo they compare to what you saw in the TxDb.Hsapiens.UCSC.hg19.knownGene package?

[ Back to top ]

Sample OrganismDb Workflow

What if you wanted to combine all the good stuff from the GO.db package with what you find in the appropriate TxDb and OrgDb packages for an organism? Then you would want to use an OrganismDb package. An example of an OrganismDb package is the Homo.sapiens package. Like the OrgDb, ChipDb and TxDb packages, it supports the use of select, keytypes, keys and columns.

## Warning: package 'OrganismDbi' was built under R version 3.1.1
library(Homo.sapiens)
keys <- head(keys(Homo.sapiens, keytype="ENTREZID"), n=2)
columns <- c("SYMBOL","TXNAME")
select(Homo.sapiens, keys, columns, keytype="ENTREZID")
## Warning in .generateExtraRows(tab, keys, jointype): 'select' resulted in
## 1:many mapping between keys and return rows
## Warning in .generateExtraRows(tab, keys, jointype): 'select' resulted in
## 1:many mapping between keys and return rows
##   ENTREZID SYMBOL     TXNAME
## 1        1   A1BG uc002qsd.4
## 2        1   A1BG uc002qsf.2
## 3       10   NAT2 uc003wyw.1

When an OrganismDb package knows about a relevant TxDb package, it can also support the ranged accessors introduced with the TxDb objects.

transcripts(Homo.sapiens, columns=c("TXNAME","SYMBOL"))
## GRanges object with 82960 ranges and 2 metadata columns:
##           seqnames               ranges strand   |          TXNAME
##              <Rle>            <IRanges>  <Rle>   | <CharacterList>
##       [1]     chr1     [ 11874,  14409]      +   |      uc001aaa.3
##       [2]     chr1     [ 11874,  14409]      +   |      uc010nxq.1
##       [3]     chr1     [ 11874,  14409]      +   |      uc010nxr.1
##       [4]     chr1     [ 69091,  70008]      +   |      uc001aal.1
##       [5]     chr1     [321084, 321115]      +   |      uc001aaq.2
##       ...      ...                  ...    ... ...             ...
##   [82956]     chrY [27605645, 27605678]      -   |      uc004fwx.1
##   [82957]     chrY [27606394, 27606421]      -   |      uc022cpc.1
##   [82958]     chrY [27607404, 27607432]      -   |      uc004fwz.3
##   [82959]     chrY [27635919, 27635954]      -   |      uc022cpd.1
##   [82960]     chrY [59358329, 59360854]      -   |      uc011ncc.1
##                    SYMBOL
##           <CharacterList>
##       [1]         DDX11L1
##       [2]         DDX11L1
##       [3]         DDX11L1
##       [4]           OR4F5
##       [5]              NA
##       ...             ...
##   [82956]              NA
##   [82957]              NA
##   [82958]              NA
##   [82959]              NA
##   [82960]              NA
##   -------
##   seqinfo: 93 sequences (1 circular) from hg19 genome

Making an OrganismDb package

You might be surprised to learn that an OrganismDb package does not itself contain very much information. Instead, it “knows where to find it”, but referencing other packages that themselves implement a select interface. So to create an OrganismDb package, you really only need to specify where the information needs to come from. Configuring an OrganismDb object is therefore pretty simple. You simply create a special list object that describes which IDs from each package are the same kind of IDs in other packages to be included, along with the relevant package names. So in the following example, the “GOID” values from the GO.db package act as foreign keys for the “GO” values in the org.Hs.eg.db package and so on.

gd <- list(join1 = c(GO.db="GOID", org.Hs.eg.db="GO"),
           join2 = c(org.Hs.eg.db="ENTREZID",
           TxDb.Hsapiens.UCSC.hg19.knownGene="GENEID"))

makeOrganismPackage(pkgname = "Homo.sapiens",
                graphData = gd,
            organism = "Homo sapiens",
            version = "1.0.0",
            maintainer = "Package Maintainer<maintainer@somewhere.org>",
            author = "Some Body",
            destDir = ".",
            license = "Artistic-2.0")

In this way, you can create a custom OrganismDb package for any organism of interest, providing that you have also have access to the supporting packages. There is a vignette that covers this topic in more detail here.

Exercises for OrganismDb objects.

Exercise 6: Use the Homo.sapiens object to look up the gene symbol, transcript start and chromosome using select(). Then do the same thing using transcripts. You might expect that this call to transcripts will look the same as it did for the TxDb object, but (temporarily) it will not.

Exercise 7: Look at the results from call the columns method on the Homo.sapiens object and compare that to what happens when you call columns on the org.Hs.eg.db object and then look at a call to columns on the TxDb.Hsapiens.UCSC.hg19.knownGene object. What is the difference between TXSTART and CHRLOC? Which one do you think you should use for transcripts or other genomic information?

[ Back to top ]

Making full use of keys

Lets look more closely at the keys method. We have already talked about how you can use it to do this:

library(Homo.sapiens)
keys <- head(keys(Homo.sapiens, keytype="ENTREZID"), n=2)

And then you can use it with select to look up other kinds of information. But what if you only know partial information about the keys you are looking up? In Bioconductor 2.13 and higher there are extra arguments for the keys method that you can make use of to find keys that match certain criteria. The most useful is probably the pattern argument. The pattern argument allows you to find out which keys match a certain pattern. So for example, you can look up entrez gene IDs that start with a “2” like this:

head(keys(Homo.sapiens, keytype="ENTREZID", pattern="^2"), n=6)
## [1] "2"      "20"     "2000"   "200008" "200010" "200014"

Or you could look up gene symbols that start with “MS”:

head(keys(Homo.sapiens, keytype="SYMBOL", pattern="^MS"), n=6)
## [1] "MS4A1" "MS4A3" "MS4A2" "MSTN"  "MSH6"  "MS"

If your string matching is too specific, you could also try to use fuzzy matching by setting the fuzzy argument to TRUE:

head(keys(Homo.sapiens, keytype="SYMBOL", pattern="^MS", fuzzy=TRUE), n=6)
## [1] "MS4A1" "MS4A3" "MS4A2" "MSTN"  "MSH6"  "LIMS1"

And if you want to match one one key and actually return another, then you can use the column argument to indicate which key you want to search for pattern on while using the keytype to indicate which kind of key you want returned. So you could (for example) get back ensembl IDs where the symbol starts with “MS”.

keys <- head(keys(Homo.sapiens, keytype="ENSEMBL", pattern="^MS", column="SYMBOL"), n=6)
keys
## [1] "ENSG00000156738" "ENSG00000149516" "ENSG00000149534" "ENSG00000138379"
## [5] "ENSG00000116062" "ENSG00000095002"
select(Homo.sapiens, keys, "SYMBOL", keytype="ENSEMBL")
##           ENSEMBL SYMBOL
## 1 ENSG00000156738  MS4A1
## 2 ENSG00000149516  MS4A3
## 3 ENSG00000149534  MS4A2
## 4 ENSG00000138379   MSTN
## 5 ENSG00000116062   MSH6
## 6 ENSG00000095002   MSH2

Exercises for OrganismDb objects.

Exercise 8: Use the Homo.sapiens object with the keys method to look up the entrez gene IDs for all gene symbols that contain the letter “X”.

[ Back to top ]

Sample AnnotationHub Workflow

So far we have been discussing annotations that are fairly well established and that represent consensus findings from the scientific community. These kinds of annotations are usually curated at large governmental institutions like NCBI or ensembl and for the most part everyone basically agrees about what they mean and how to use them.

But sometimes the annotations that you need are not as well established. Sometimes (for example) we just need to compare our results to the data from a recent large study such as the encode project. The AnnotationHub package is designed to be useful for getting access to data like this. AnnotationHub allows you to get access to data from a range of different data reposotories, with the caveat that the data objects in AnnotationHub have all been pre-processed into appropriate R objects for you.

To make use of AnnotationHub, you need to load the package and then create an AnnotationHub object. Notice that unlike the other packages, with AnnotationHub, you have to create an AnnotationHub object when you 1st start up your R session.

library(AnnotationHub)

ah = AnnotationHub()

Once you have done this, you can “find” any of the available resources just by tab completing along a path like this.

res <- ah$goldenpath.hg19.encodeDCC.wgEncodeUwTfbs.wgEncodeUwTfbsMcf7CtcfStdPkRep1.narrowPeak_0.0.1.RData

res
## GRanges object with 82163 ranges and 6 metadata columns:
##           seqnames                 ranges strand   |        name     score
##              <Rle>              <IRanges>  <Rle>   | <character> <integer>
##       [1]     chr1       [237640, 237790]      *   |           .         0
##       [2]     chr1       [544660, 544810]      *   |           .         0
##       [3]     chr1       [567480, 567630]      *   |           .         0
##       [4]     chr1       [569820, 569970]      *   |           .         0
##       [5]     chr1       [714200, 714350]      *   |           .         0
##       ...      ...                    ...    ... ...         ...       ...
##   [82159]     chrX [154764540, 154764690]      *   |           .         0
##   [82160]     chrX [154807400, 154807550]      *   |           .         0
##   [82161]     chrX [154881060, 154881210]      *   |           .         0
##   [82162]     chrX [154892100, 154892250]      *   |           .         0
##   [82163]     chrX [154916040, 154916190]      *   |           .         0
##           signalValue    pValue    qValue      peak
##             <numeric> <numeric> <numeric> <integer>
##       [1]          30  26.89200        -1        -1
##       [2]           6   8.16393        -1        -1
##       [3]         100  56.71760        -1        -1
##       [4]          85  49.65350        -1        -1
##       [5]          17  13.18360        -1        -1
##       ...         ...       ...       ...       ...
##   [82159]          26   25.2917        -1        -1
##   [82160]          22   27.6521        -1        -1
##   [82161]          17   16.4194        -1        -1
##   [82162]          72  101.6090        -1        -1
##   [82163]          32   32.5209        -1        -1
##   -------
##   seqinfo: 23 sequences from hg19 genome

In the above example, AnnotationHub will retrieve, download and cache locally the file that you tab-completed to, and then store the results in “res”.

Now you can see how many ways there are to currently complete that path, by checking the length of the AnnotationHub object:

length(ah)
## [1] 10780

The AnnotationHub is still a pretty new resource, and we already hav a LOT of things in there! How can we narrow this down? Right now we can use filters. By default, there are no filters applied, so calling filters() on our AnnotationHub is just an empty list.

filters(ah)
## list()

What things can be used as filters? We can use the columns() method to find out.

columns(ah)
##  [1] "BiocVersion"        "DataProvider"       "Title"             
##  [4] "SourceFile"         "Species"            "SourceUrl"         
##  [7] "SourceVersion"      "TaxonomyId"         "Genome"            
## [10] "Description"        "Tags"               "RDataClass"        
## [13] "RDataPath"          "Coordinate_1_based" "Maintainer"        
## [16] "RDataVersion"       "RDataDateAdded"     "Recipe"

What values can be used with these filters? Here, the keys method will give us an answer.

head(keys(ah, keytype="Species"))
## [1] "9606"                   "Acromyrmex echinatior" 
## [3] "Acyrthosiphon pisum"    "Aedes aegypti"         
## [5] "Agaricus bisporus"      "Ailuropoda melanoleuca"

So now we know what we need to apply a filter to our AnnotationHub. The following filter will limit our AnnotationHub to just those entries that correspond to cattle (Bos taurus).

filters(ah) <- list(Species="Bos taurus")

length(ah)
## [1] 145

We can also view and filter our AnnotationHub object interactively by simply calling the display function on it

d <- display(ah)

We can then filter the AnnotationHub object for “Homo sapiens” by either using the Global search field on the top right corner of the page or the in-column search field for “Species”.

By default 1000 entries are displayed per page, we can change this using the filter on the top of the page or navigate through different pages using the page scrolling feature at the bottom of the page.

We can also select the rows of interest to us and send them back to the R session using 'Send Rows' button ; this sets a filter internally which filters the AnnotationHub object.

[ Back to top ]

Exercises for AnnotationHub.

Exercise 9: Set the AnnotationHub filter to NULL to clear it out, and then set ip up so that it is extracting data that originated with the UCSC data provider and that is also limited to Homo sapiens and the hg19 genome.

Exercise 10 Now that you have basically narrowed things down to the hg19 annotations from UCSC genome browser, lets get one of these annotations. Now tab complete your way to the oreganno track and save it into a local variable.

[ Back to top ]

Using biomaRt

Another valuable resource is the biomaRt package. The biomaRt package exposes a huge family of online annotation resources called marts. Here is a brief run down of how to use it. For the first step, load the package and decide which “mart” you want to use, then use the useMart() method to create a mart object

library("biomaRt")
## Warning: package 'biomaRt' was built under R version 3.1.1
head(listMarts())
##               biomart                             version
## 1             ensembl        ENSEMBL GENES 77 (SANGER UK)
## 2                 snp    ENSEMBL VARIATION 77 (SANGER UK)
## 3 functional_genomics   ENSEMBL REGULATION 77 (SANGER UK)
## 4                vega                VEGA 57  (SANGER UK)
## 5       fungi_mart_23           ENSEMBL FUNGI 23 (EBI UK)
## 6 fungi_variations_23 ENSEMBL FUNGI VARIATION 23 (EBI UK)
ensembl <- useMart("ensembl")
ensembl
## Object of class 'Mart':
##  Using the ensembl BioMart database
##  Using the  dataset

Next you need to decide on a dataset. This can also be specified in the mart object that is created when you call the the useMart() method.

head(listDatasets(ensembl))
##                          dataset
## 1         oanatinus_gene_ensembl
## 2        cporcellus_gene_ensembl
## 3        gaculeatus_gene_ensembl
## 4         lafricana_gene_ensembl
## 5 itridecemlineatus_gene_ensembl
## 6        choffmanni_gene_ensembl
##                                  description version
## 1     Ornithorhynchus anatinus genes (OANA5)   OANA5
## 2            Cavia porcellus genes (cavPor3) cavPor3
## 3     Gasterosteus aculeatus genes (BROADS1) BROADS1
## 4         Loxodonta africana genes (loxAfr3) loxAfr3
## 5 Ictidomys tridecemlineatus genes (spetri2) spetri2
## 6        Choloepus hoffmanni genes (choHof1) choHof1
ensembl <- useMart("ensembl",dataset="hsapiens_gene_ensembl")
ensembl
## Object of class 'Mart':
##  Using the ensembl BioMart database
##  Using the hsapiens_gene_ensembl dataset

Next we need to think about filters and values. In the biomaRt package, filters are things that can be used with values to restrict or choose what comes back. So you might choose a filter of “affy_hg_u133_plus_2” to go with specific values. For example you might choose c(“202763_at”,“209310_s_at”,“207500_at”) to go with the filter “affy_hg_u133_plus_2”. Together these two things would request things that matched those probeset IDs on the platform listed as the filter. There is an accessor for the kinds of filters that are available from a given mart/dataset:

head(listFilters(ensembl))
##              name     description
## 1 chromosome_name Chromosome name
## 2           start Gene Start (bp)
## 3             end   Gene End (bp)
## 4      band_start      Band Start
## 5        band_end        Band End
## 6    marker_start    Marker Start

Also, you need to know about attributes. Attributes here mean the things that you want returned. So if you want to know the gene symbol or something like that. You would list that as an attribute. There are accessors to list the kinds of attributes you can look up too:

head(listAttributes(ensembl))
##                    name           description
## 1       ensembl_gene_id       Ensembl Gene ID
## 2 ensembl_transcript_id Ensembl Transcript ID
## 3    ensembl_peptide_id    Ensembl Protein ID
## 4       ensembl_exon_id       Ensembl Exon ID
## 5           description           Description
## 6       chromosome_name       Chromosome Name

Once you are done exploring and know what you want to extract, you can call the getBM method to get your data like this:

affyids=c("202763_at","209310_s_at","207500_at")
getBM(attributes=c('affy_hg_u133_plus_2', 'entrezgene'), 
                    filters = 'affy_hg_u133_plus_2', 
                    values = affyids, mart = ensembl)
##   affy_hg_u133_plus_2 entrezgene
## 1         209310_s_at        837
## 2           207500_at        838
## 3           202763_at        836

Now what would you do if you didn't know what the possible values are for a given filter? Well you could just request all the possible values by not specifying the filter, and instead only specifying it as an attribute like this:

head(getBM(attributes='affy_hg_u133_plus_2', mart = ensembl))
##   affy_hg_u133_plus_2
## 1        1568377_x_at
## 2           238066_at
## 3         208528_x_at
## 4           203516_at
## 5           219855_at
## 6           203261_at

Of course if you find the standard biomaRt methods difficult to work with, you can now also use the standard select methods here.

[ Back to top ]

Exercises for biomaRt.

Exercise 11: Pull down GO terms for entrez gene id “1” from human by using the ensembl “hsapiens_gene_ensembl” dataset.

Exercise 12: Now compare the GO terms you just pulled down to the same GO terms from the org.Hs.eg.db package (which you can now retrieve using select()). What differences do you notice? Why do you suspect that is?

[ Back to top ]

BSgenome packages

There are many BSgenome packages in the repository too. These packages contain sequence data for sequenced organisms. You can load one of these packages just like this:

library(BSgenome.Hsapiens.UCSC.hg19)
ls(2)
##  [1] "NP2009code"     "attributePages" "columns"        "exportFASTA"   
##  [5] "filterOptions"  "filterType"     "getBM"          "getBMlist"     
##  [9] "getGene"        "getLDS"         "getSequence"    "getXML"        
## [13] "keys"           "keytypes"       "listAttributes" "listDatasets"  
## [17] "listFilters"    "listMarts"      "select"         "show"          
## [21] "useDataset"     "useMart"
Hsapiens
## Human genome
## | 
## | organism: Homo sapiens (Human)
## | provider: UCSC
## | provider version: hg19
## | release date: Feb. 2009
## | release name: Genome Reference Consortium GRCh37
## | 
## | 93 single sequences:
## |   chr1                  chr2                  chr3                 
## |   chr4                  chr5                  chr6                 
## |   chr7                  chr8                  chr9                 
## |   chr10                 chr11                 chr12                
## |   chr13                 chr14                 chr15                
## |   ...                   ...                   ...                  
## |   chrUn_gl000235        chrUn_gl000236        chrUn_gl000237       
## |   chrUn_gl000238        chrUn_gl000239        chrUn_gl000240       
## |   chrUn_gl000241        chrUn_gl000242        chrUn_gl000243       
## |   chrUn_gl000244        chrUn_gl000245        chrUn_gl000246       
## |   chrUn_gl000247        chrUn_gl000248        chrUn_gl000249       
## | (use 'seqnames()' to see all the single sequence names, use the '$' or
## | '[[' operator to access a given single sequence)
## | 
## | multiple sequences:
## |   upstream1000 upstream2000 upstream5000                          
## | (use 'mseqnames()' to see all the multiple sequence names, use the '$' or
## | '[[' operator to access a given multiple sequence)

The getSeq method is useful for extracting data from these pacakges. This method takes several arguments but the important ones are the 1st two. The 1st argument specifies the BSgenome object to use and the second argument (names) specifies what data you want back out. So for example, if you call it and give a character vector that names the seqnames for the object then you will get the sequences from those chromosomes as a DNAStringSet object.

seqNms <- seqnames(Hsapiens)
head(seqNms)
## [1] "chr1" "chr2" "chr3" "chr4" "chr5" "chr6"
getSeq(Hsapiens, seqNms[1:2])
##   A DNAStringSet instance of length 2
##         width seq
## [1] 249250621 NNNNNNNNNNNNNNNNNNNNNNNNNNNNN...NNNNNNNNNNNNNNNNNNNNNNNNNNNNN
## [2] 243199373 NNNNNNNNNNNNNNNNNNNNNNNNNNNNN...NNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Whereas if you give the a GRanges object for the 2nd argument, you can instead get a DNA StringSet that corresponds to those ranges.

rngs <- GRanges(seqnames = c('chr1', 'chr4'), strand=c('+','-'),
                ranges = IRanges(start=c(100000,300000), 
                                 end=c(100023,300037)))
rngs
## GRanges object with 2 ranges and 0 metadata columns:
##       seqnames           ranges strand
##          <Rle>        <IRanges>  <Rle>
##   [1]     chr1 [100000, 100023]      +
##   [2]     chr4 [300000, 300037]      -
##   -------
##   seqinfo: 2 sequences from an unspecified genome; no seqlengths
res <- getSeq(Hsapiens, rngs)
res
##   A DNAStringSet instance of length 2
##     width seq
## [1]    24 CACTAAGCACACAGAGAATAATGT
## [2]    38 GCTGGTCCCTTACTTCCAGTAGAAAAGACGTGTTCAGG

This can be a very powerful way to quickly get sequences of interest. And for more useful tools the BSgenome package also has useful functions for finding a pattern in a string set etc.

[ Back to top ]

Installation and Use

Follow installation instructions to start using these packages. To install the annotations associated with the Affymetrix Human Genome U95 V 2.0, and with Gene Ontology, use

source("http://bioconductor.org/biocLite.R")
biocLite(c("hgu95av2.db", "GO.db"))

Package installation is required only once per R installation. View a full list of available software and annotation packages.

To use the AnnotationDbi and GO.db package, evaluate the commands

library(AnnotationDbi)
library(GO.db)

These commands are required once in each R session.

[ Back to top ]

Exploring Package Content

Packages have extensive help pages, and include vignettes highlighting common use cases. The help pages and vignettes are available from within R. After loading a package, use syntax like

help(package="GO.db")
?select

to obtain an overview of help on the GO.db package, and the select method. The AnnotationDbi package is used by most .db packages. View the vignettes in the AnnotationDbi package with

browseVignettes(package="AnnotationDbi")

To view vignettes (providing a more comprehensive introduction to package functionality) in the AnnotationDbi package. Use

help.start()

To open a web page containing comprehensive help resources.

[ Back to top ]

Annotation Resources

The following guides the user through key annotation packages. Users interested in how to create custom chip packages should see the vignettes in the AnnotationForge package. There is additional information in the AnnotationDbi, OrganismDbi and GenomicFeatures packages for how to use some of the extra tools provided. You can also refer to the complete list of annotation packages.

Key Packages

Types of Annotation Packages

[ Back to top ]

Answers for exercises:

Exercise 1:

keys <- "MSX2"
columns <- c("ENTREZID", "CHR")
select(org.Hs.eg.db, keys, columns, keytype="SYMBOL")
##   SYMBOL ENTREZID CHR
## 1   MSX2     4488   5

Exercise 2:

## 1st get all the gene symbols
orgSymbols <- keys(org.Hs.eg.db, keytype="SYMBOL")
## and then use that to get all gene symbols matched to all entrez gene IDs
egr <- select(org.Hs.eg.db, keys=orgSymbols, "ENTREZID", "SYMBOL")
## Warning in .generateExtraRows(tab, keys, jointype): 'select' resulted in
## 1:many mapping between keys and return rows
length(egr$ENTREZID)
## [1] 47721
length(unique(egr$ENTREZID))
## [1] 47721
## VS:
length(egr$SYMBOL)
## [1] 47721
length(unique(egr$SYMBOL))
## [1] 47711
## So lets trap these symbols that are redundant and look more closely...
redund <- egr$SYMBOL
badSymbols <- redund[duplicated(redund)]
select(org.Hs.eg.db, badSymbols, "ENTREZID", "SYMBOL")
## Warning in .generateExtraRows(tab, keys, jointype): 'select' resulted in
## 1:many mapping between keys and return rows
##       SYMBOL  ENTREZID
## 1     CSNK1E      1454
## 2     CSNK1E 102800317
## 3        HBD      3045
## 4        HBD 100187828
## 5       RNR1      4549
## 6       RNR1      6052
## 7       RNR2      4550
## 8       RNR2      6053
## 9       SFPQ      6421
## 10      SFPQ    654780
## 11       TEC      7006
## 12       TEC 100124696
## 13     MEMO1      7795
## 14     MEMO1     51072
## 15   KIR3DL3    115653
## 16   KIR3DL3 100133046
## 17      MMD2    221938
## 18      MMD2 100505381
## 19 LSAMP-AS1 100506708
## 20 LSAMP-AS1 101926903

Exercise 3:

Initially you might expect that hgu95av2.db will have less information in it. After all, it's an old Affymetrix platform that was developed before we even had a very complete human genome. So you might try something like this:

chipSymbols <- keys(hgu95av2.db, keytype="SYMBOL")
orgSymbols <- keys(org.Hs.eg.db, keytype="SYMBOL")
length(orgSymbols)
## [1] 47711
length(chipSymbols)
## [1] 47711

And you might feel confused and so you might try this:

dim(select(org.Hs.eg.db,orgSymbols, "ENTREZID", "SYMBOL"))
## Warning in .generateExtraRows(tab, keys, jointype): 'select' resulted in
## 1:many mapping between keys and return rows
## [1] 47721     2
dim(select(hgu95av2.db,chipSymbols, "ENTREZID", "SYMBOL")) 
## Warning in .generateExtraRows(tab, keys, jointype): 'select' resulted in
## 1:many mapping between keys and return rows
## [1] 47721     2

And you might also have noticed this:

length(columns(org.Hs.eg.db)) < length(columns(hgu95av2.db))
## [1] TRUE

Well the answer you have in front of you is actually correct. There actually is more information available in the hgu95av2.db object than in the org.Hs.eg.db object. This is because even though the hgu95av2.db object technically can only have probes for some genes in the genome, it still (behind the scenes) retrieves data about gene names etc. from the org.Hs.eg.db package. So it effectively has access to all the data from the org package PLUS the probes for that platform and what those map to. So that means that for there will be information about many gene symbols that don't actually match up to any probeset Ids. And that is what we see if we use gene symbols to look up the probes Ids.

head(select(hgu95av2.db,chipSymbols, "PROBEID", "SYMBOL"))
##   SYMBOL  PROBEID
## 1   A1BG     <NA>
## 2    A2M     <NA>
## 3  A2MP1     <NA>
## 4   NAT1 38187_at
## 5   NAT2 38912_at
## 6   NATP     <NA>

Exercise 4:

So to retrieve this information using select you need to do it like this:

res1 <- select(TxDb.Hsapiens.UCSC.hg19.knownGene, 
               keys(TxDb.Hsapiens.UCSC.hg19.knownGene, keytype="TXID"),
               columns=c("GENEID","TXNAME","TXCHROM"), keytype="TXID")

head(res1)
##   TXID    GENEID     TXNAME TXCHROM
## 1    1 100287102 uc001aaa.3    chr1
## 2    2 100287102 uc010nxq.1    chr1
## 3    3 100287102 uc010nxr.1    chr1
## 4    4     79501 uc001aal.1    chr1
## 5    5      <NA> uc001aaq.2    chr1
## 6    6      <NA> uc001aar.2    chr1

And to do it using transcripts you do it like this:

res2 <- transcripts(TxDb.Hsapiens.UCSC.hg19.knownGene, 
                    columns = c("gene_id","tx_name")) 
head(res2)
## GRanges object with 6 ranges and 2 metadata columns:
##       seqnames           ranges strand |         gene_id     tx_name
##          <Rle>        <IRanges>  <Rle> | <CharacterList> <character>
##   [1]     chr1 [ 11874,  14409]      + |       100287102  uc001aaa.3
##   [2]     chr1 [ 11874,  14409]      + |       100287102  uc010nxq.1
##   [3]     chr1 [ 11874,  14409]      + |       100287102  uc010nxr.1
##   [4]     chr1 [ 69091,  70008]      + |           79501  uc001aal.1
##   [5]     chr1 [321084, 321115]      + |                  uc001aaq.2
##   [6]     chr1 [321146, 321207]      + |                  uc001aar.2
##   -------
##   seqinfo: 93 sequences (1 circular) from hg19 genome

Notice that in the 2nd case we don't have to ask for the chromosome, as transcripts() returns a GRanges object, so the chromosome will automatically be returned as part of the object.

Exercise 5:

library(TxDb.Athaliana.BioMart.plantsmart22)
res <- transcripts(TxDb.Athaliana.BioMart.plantsmart22, columns = c("gene_id")) 

You will notice that the gene ids for this package are TAIR locus IDs and are NOT entrez gene IDs like what you saw in the TxDb.Hsapiens.UCSC.hg19.knownGene package. It's important to always pay attention to the kind of gene id is being used by the TxDb you are looking at.

Exercise 6:

library(Homo.sapiens)
keys <- keys(Homo.sapiens, keytype="TXID")
res1 <- select(Homo.sapiens, 
               keys= keys,
               columns=c("SYMBOL","TXSTART","TXCHROM"), keytype="TXID")

head(res1)

And to do it using transcripts you do it like this:

library(Homo.sapiens)
res2 <- transcripts(Homo.sapiens, columns="SYMBOL") 
head(res2)
## GRanges object with 6 ranges and 1 metadata column:
##       seqnames           ranges strand |          SYMBOL
##          <Rle>        <IRanges>  <Rle> | <CharacterList>
##   [1]     chr1 [ 11874,  14409]      + |         DDX11L1
##   [2]     chr1 [ 11874,  14409]      + |         DDX11L1
##   [3]     chr1 [ 11874,  14409]      + |         DDX11L1
##   [4]     chr1 [ 69091,  70008]      + |           OR4F5
##   [5]     chr1 [321084, 321115]      + |              NA
##   [6]     chr1 [321146, 321207]      + |              NA
##   -------
##   seqinfo: 93 sequences (1 circular) from hg19 genome

Exercise 7:

columns(Homo.sapiens)
##  [1] "GOID"         "TERM"         "ONTOLOGY"     "DEFINITION"  
##  [5] "ENTREZID"     "PFAM"         "IPI"          "PROSITE"     
##  [9] "ACCNUM"       "ALIAS"        "CHR"          "CHRLOC"      
## [13] "CHRLOCEND"    "ENZYME"       "MAP"          "PATH"        
## [17] "PMID"         "REFSEQ"       "SYMBOL"       "UNIGENE"     
## [21] "ENSEMBL"      "ENSEMBLPROT"  "ENSEMBLTRANS" "GENENAME"    
## [25] "UNIPROT"      "GO"           "EVIDENCE"     "GOALL"       
## [29] "EVIDENCEALL"  "ONTOLOGYALL"  "OMIM"         "UCSCKG"      
## [33] "CDSID"        "CDSNAME"      "CDSCHROM"     "CDSSTRAND"   
## [37] "CDSSTART"     "CDSEND"       "EXONID"       "EXONNAME"    
## [41] "EXONCHROM"    "EXONSTRAND"   "EXONSTART"    "EXONEND"     
## [45] "GENEID"       "TXID"         "EXONRANK"     "TXNAME"      
## [49] "TXCHROM"      "TXSTRAND"     "TXSTART"      "TXEND"
columns(org.Hs.eg.db)
##  [1] "ENTREZID"     "PFAM"         "IPI"          "PROSITE"     
##  [5] "ACCNUM"       "ALIAS"        "CHR"          "CHRLOC"      
##  [9] "CHRLOCEND"    "ENZYME"       "MAP"          "PATH"        
## [13] "PMID"         "REFSEQ"       "SYMBOL"       "UNIGENE"     
## [17] "ENSEMBL"      "ENSEMBLPROT"  "ENSEMBLTRANS" "GENENAME"    
## [21] "UNIPROT"      "GO"           "EVIDENCE"     "ONTOLOGY"    
## [25] "GOALL"        "EVIDENCEALL"  "ONTOLOGYALL"  "OMIM"        
## [29] "UCSCKG"
columns(TxDb.Hsapiens.UCSC.hg19.knownGene)
##  [1] "CDSID"      "CDSNAME"    "CDSCHROM"   "CDSSTRAND"  "CDSSTART"  
##  [6] "CDSEND"     "EXONID"     "EXONNAME"   "EXONCHROM"  "EXONSTRAND"
## [11] "EXONSTART"  "EXONEND"    "GENEID"     "TXID"       "EXONRANK"  
## [16] "TXNAME"     "TXCHROM"    "TXSTRAND"   "TXSTART"    "TXEND"
## You might also want to look at this:
transcripts(Homo.sapiens, columns=c("SYMBOL","CHRLOC"))
## Warning in .generateExtraRows(tab, keys, jointype): 'select' resulted in
## 1:many mapping between keys and return rows
## Warning in .generateExtraRows(tab, keys, jointype): 'select' resulted in
## 1:many mapping between keys and return rows
## GRanges object with 82960 ranges and 3 metadata columns:
##           seqnames               ranges strand   |        CHRLOC
##              <Rle>            <IRanges>  <Rle>   | <IntegerList>
##       [1]     chr1     [ 11874,  14409]      +   |         11874
##       [2]     chr1     [ 11874,  14409]      +   |         11874
##       [3]     chr1     [ 11874,  14409]      +   |         11874
##       [4]     chr1     [ 69091,  70008]      +   |         69091
##       [5]     chr1     [321084, 321115]      +   |            NA
##       ...      ...                  ...    ... ...           ...
##   [82956]     chrY [27605645, 27605678]      -   |            NA
##   [82957]     chrY [27606394, 27606421]      -   |            NA
##   [82958]     chrY [27607404, 27607432]      -   |            NA
##   [82959]     chrY [27635919, 27635954]      -   |            NA
##   [82960]     chrY [59358329, 59360854]      -   |            NA
##                 CHRLOCCHR          SYMBOL
##           <CharacterList> <CharacterList>
##       [1]               1         DDX11L1
##       [2]               1         DDX11L1
##       [3]               1         DDX11L1
##       [4]               1           OR4F5
##       [5]              NA              NA
##       ...             ...             ...
##   [82956]              NA              NA
##   [82957]              NA              NA
##   [82958]              NA              NA
##   [82959]              NA              NA
##   [82960]              NA              NA
##   -------
##   seqinfo: 93 sequences (1 circular) from hg19 genome

The key difference is that the TXSTART refers to the start of a transcript and originates in the TxDb object from the TxDb.Hsapiens.UCSC.hg19.knownGene package, while the CHRLOC refers to the same thing but originates in the OrgDb object from the org.Hs.eg.db package. The point of origin is significant because the TxDb object represents a transcriptome from UCSC and the OrgDb is primarily gene centric data that originates at NCBI. The upshot is that CHRLOC will not have as many regions represented as TXSTART, since there has to be an official gene for there to even be a record. The CHRLOC data is also locked in for org.Hs.eg.db as data for hg19, whereas you can swap in a different TxDb object to match the genome you are using to make it hg18 etc. For these reasons, we strongly recommend using TXSTART instead of CHRLOC. Howeverm CHRLOC still remains in the org packages for historical reasons.

Exercise 8

To find the keys that match, make use of the pattern and column arguments.

library(Homo.sapiens)
xk = head(keys(Homo.sapiens, keytype="ENTREZID", pattern="X", column="SYMBOL"))
xk
## [1] "100033409" "100033411" "100038246" "100048904" "100048923" "100101111"

select verifies the results

select(Homo.sapiens, xk, "SYMBOL", "ENTREZID")
##    ENTREZID   SYMBOL
## 1 100033409   OTX2P1
## 2 100033411     DUXB
## 3 100038246   TLX1NB
## 4 100048904 DDX39BP1
## 5 100048923 DDX39BP2
## 6 100101111 GXYLT1P1

Exercise 9:

The 1st thing you need to do is look at the keytypes:

keytypes(ah)
##  [1] "BiocVersion"        "DataProvider"       "Title"             
##  [4] "SourceFile"         "Species"            "SourceUrl"         
##  [7] "SourceVersion"      "TaxonomyId"         "Genome"            
## [10] "Description"        "Tags"               "RDataClass"        
## [13] "RDataPath"          "Coordinate_1_based" "Maintainer"        
## [16] "RDataVersion"       "RDataDateAdded"     "Recipe"

Then you want to look at possible values for DataProvider and for Genome.

keys(ah, keytype="DataProvider")
## [1] "EncodeDCC"                                             
## [2] "ftp.ensembl.org"                                       
## [3] "ftp://ftp.ncbi.nih.gov/snp"                            
## [4] "HAEMCODE"                                              
## [5] "hgdownload.cse.ucsc.edu"                               
## [6] "http://inparanoid.sbc.su.se/download/current/Orthologs"
## [7] "RefNet"
head(keys(ah, keytype="Genome"))
## [1] "ailMel1"   "anoCar1"   "anoCar2"   "AnoCar2.0" "anoGam1"   "apiMel1"
filters(ah) <- NULL
filters(ah) <- list(Species="Homo sapiens", 
                    DataProvider="hgdownload.cse.ucsc.edu",
            Genome="hg19")
length(ah)
## [1] 118

Exercise 10:

This pulls down the oreganno annotations. Which are described on the UCSC site thusly: “This track displays literature-curated regulatory regions, transcription factor binding sites, and regulatory polymorphisms from ORegAnno (Open Regulatory Annotation). For more detailed information on a particular regulatory element, follow the link to ORegAnno from the details page.”

res <- ah$goldenpath.hg19.database.oreganno_0.0.1.RData

Exercise 11:

library("biomaRt")
ensembl <- useMart("ensembl",dataset="hsapiens_gene_ensembl")
ids=c("1")
getBM(attributes=c('go_id', 'entrezgene'), 
            filters = 'entrezgene',
                    values = ids, mart = ensembl)
##        go_id entrezgene
## 1 GO:0003674          1
## 2 GO:0005576          1
## 3 GO:0005615          1
## 4 GO:0008150          1
## 5 GO:0070062          1
## 6 GO:0072562          1
## 7 GO:0005515          1

Exercise 12:

library(org.Hs.eg.db)
ids=c("1")
select(org.Hs.eg.db, keys=ids, columns="GO", keytype="ENTREZID")
## Warning in .generateExtraRows(tab, keys, jointype): 'select' resulted in
## 1:many mapping between keys and return rows
##   ENTREZID         GO EVIDENCE ONTOLOGY
## 1        1 GO:0003674       ND       MF
## 2        1 GO:0005576      IDA       CC
## 3        1 GO:0005615      IDA       CC
## 4        1 GO:0008150       ND       BP
## 5        1 GO:0070062      IDA       CC
## 6        1 GO:0072562      IDA       CC

When this exercise was written, there was a different number of GO terms returned from biomaRt than from org.Hs.eg.db. This may not always be true in the future though as both of these resources are updated. It is expected however that this web service, (which is updated continuously) will fall in and out of sync with the org.Hs.eg.db package (which is updated twice a year). This is an important difference as each approach has different advantages and disadvantages. The advantage to updating continuously is that you always have the very latest annotations which are frequently different for something like GO terms. The advantage to using a package is that the results are frozen to a release of Bioconductor. And this can help you to get the same answers that you get today (reproducibility), a few years from now.

[ Back to top ]

SessionInfo

sessionInfo()
## R version 3.1.0 (2014-04-10)
## Platform: x86_64-apple-darwin10.8.0 (64-bit)
## 
## locale:
## [1] C
## 
## attached base packages:
## [1] stats4    parallel  stats     graphics  grDevices utils     datasets 
## [8] methods   base     
## 
## other attached packages:
##  [1] TxDb.Athaliana.BioMart.plantsmart22_3.0.0
##  [2] biomaRt_2.22.0                           
##  [3] Homo.sapiens_1.1.2                       
##  [4] OrganismDbi_1.8.0                        
##  [5] hgu95av2.db_3.0.0                        
##  [6] GO.db_3.0.0                              
##  [7] parathyroidSE_1.3.2                      
##  [8] ensemblVEP_1.6.0                         
##  [9] BSgenome.Hsapiens.UCSC.hg19_1.3.99       
## [10] BSgenome_1.34.0                          
## [11] rtracklayer_1.26.1                       
## [12] org.Mm.eg.db_3.0.0                       
## [13] org.Hs.eg.db_3.0.0                       
## [14] RSQLite_0.11.4                           
## [15] DBI_0.3.1                                
## [16] TxDb.Mmusculus.UCSC.mm10.ensGene_3.0.0   
## [17] TxDb.Hsapiens.UCSC.hg19.knownGene_3.0.0  
## [18] GenomicFeatures_1.18.1                   
## [19] AnnotationDbi_1.28.0                     
## [20] Biobase_2.26.0                           
## [21] AnnotationHub_1.6.0                      
## [22] VariantAnnotation_1.12.1                 
## [23] Rsamtools_1.18.0                         
## [24] Biostrings_2.34.0                        
## [25] XVector_0.6.0                            
## [26] GenomicRanges_1.18.1                     
## [27] GenomeInfoDb_1.2.0                       
## [28] IRanges_2.0.0                            
## [29] S4Vectors_0.4.0                          
## [30] BiocGenerics_0.12.0                      
## 
## loaded via a namespace (and not attached):
##  [1] BBmisc_1.7                   BatchJobs_1.4               
##  [3] BiocInstaller_1.16.0         BiocParallel_1.0.0          
##  [5] Category_2.32.0              GSEABase_1.28.0             
##  [7] GenomicAlignments_1.2.0      MASS_7.3-35                 
##  [9] Matrix_1.1-4                 R6_2.0                      
## [11] RBGL_1.42.0                  RColorBrewer_1.0-5          
## [13] RCurl_1.95-4.3               RJSONIO_1.3-0               
## [15] Rcpp_0.11.3                  XML_3.98-1.1                
## [17] annotate_1.44.0              base64enc_0.1-2             
## [19] bitops_1.0-6                 brew_1.0-6                  
## [21] checkmate_1.5.0              codetools_0.2-9             
## [23] colorspace_1.2-4             digest_0.6.4                
## [25] evaluate_0.5.5               fail_1.2                    
## [27] foreach_1.4.2                formatR_1.0                 
## [29] genefilter_1.48.1            ggplot2_1.0.0               
## [31] graph_1.44.0                 grid_3.1.0                  
## [33] gridSVG_1.4-0                gtable_0.1.2                
## [35] htmltools_0.2.6              httpuv_1.3.0                
## [37] httr_0.5                     interactiveDisplay_1.4.0    
## [39] interactiveDisplayBase_1.4.0 iterators_1.0.7             
## [41] knitr_1.7                    lattice_0.20-29             
## [43] markdown_0.7.4               mime_0.2                    
## [45] munsell_0.4.2                plyr_1.8.1                  
## [47] proto_0.3-10                 reshape2_1.4                
## [49] rjson_0.2.14                 scales_0.2.4                
## [51] sendmailR_1.2-1              shiny_0.10.2.1              
## [53] splines_3.1.0                stringr_0.6.2               
## [55] survival_2.37-7              tools_3.1.0                 
## [57] xtable_1.7-4                 zlibbioc_1.12.0

[ Back to top ]